lyndseyfrank8258 lyndseyfrank8258

03-10-2019
Geography

contestada

42. What do we observe that indicates most objects in the universe are moving away from each other? A) Blue shift of stars and galaxies B) Red shift of stars and galaxies C) The universe and galaxies are all rotating D) Galaxies are many light years apart the further they are from the Sun.

Respuesta :

seth5467 seth5467

03-10-2019

A and can you help me with my geography homework please it is-
Question - To what extent can ecotourism be used as a strategy for sustainable development in Costa Rica. (9 Marks)

Answer Link

Otras preguntas

testosterone directly affects the

Solve the equation -10 + 3x + 5x = -56 ? ??

Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October

Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5

The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front

A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front