shukriibrahim36 shukriibrahim36

03-12-2020
Biology

contestada

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Respuesta :

keyonaaaaa keyonaaaaa

03-12-2020

I don’t feel like answering all that but....
C=G G=C T=A A=U

Answer Link

vicgraisi1220 vicgraisi1220

03-12-2020

C=G A=T dont know the rest have a gcodocododd dday

Answer Link

Otras preguntas

What is the approximate straight-line distance in miles between Athens and Rome

how did the kaiser's desire for respect influence his policies?

The compound NaOH(s) dissolves in water to yield (1) hydroxide ions as the only negative ions (2) hydroxide ions as the only positive ions (3) hydronium ions as

Which list of elements contains two metalloids?(1) Si, Ge, Po, Pb (3) Si, P, S, Cl(2) As, Bi, Br, Kr (4) Po, Sb, I, Xe

How many tenths are there in 9 4/5

explain how did the creation of new states change the political boundaries of the great plains

1kg of cheese is 5.60 how much is 200g

PLEASE HELP Solve. 5x+2/2 = 2x - 1 X = ________ ?

Why do we only see only one side of the moon from Earth A. the moon does not rotate B. the moon takes longer to rotate then to revolve around Earth C. the moon

Given the balanced equation representing a reaction: CH3CH2CH3 + Br2==> CH3CH2CH2Br + HBr This organic reaction is best classified as (1) an addition reactio