jalaladeealkobadi001 jalaladeealkobadi001

04-03-2021
Mathematics

contestada

10 cm 8 cm 14 cm 7 cm 6 cm 15 cm What is the total area of the figure ?

A 373cm2
B 338cm2
C 303cm2
D 268cm2

Respuesta :

angelatan0774 angelatan0774

04-03-2021

Answer:

please include an image for the question

Answer Link

Otras preguntas

Multivitamin/mineral supplements should never be given to toddlers. a. True b. False

What US policy was designed to handle the threat of communism spreading to the Middle East in the 1950s? A. The Kennan plan B. The Middle East doctrine C. Th

Which of the following have at least two congruent parallel bases? all that apply. A. Cylinder B. Circle C. Cone D. Cube E. None of these F

What is one key difference between the radiation and convection zones?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

a triangle has a measure of 30. The other two angles are in a ratio of 7:8. What are the measures of those two angles?

Jacky spent 53% of all her money to buy a computer game. How much did the game cost, if Jacky had $120 before buying the game?

Which of the following is true about a writer’s diction? a.When the writer uses sophisticated vocabulary, the diction is informal. b.When the writer uses comple

Which phrase states a principle that was part of president woodrow wilson's fourteen points?

What does Thomas Jefferson mean by Certain unalienable rights and the in the excerpt from the Declaration of Independence